hhh942409 hhh942409

07-06-2023
Mathematics

contestada

3.
What is the sum of the first 19 terms of the sequence
3, 10, 17, 24, 31, ...P
(1) 1188
(2) 1197
(3) 1254
(4) 1292

Respuesta :

Otras preguntas

In the following sentence, which word is an adverb used to modify an adjective? It was quite late for a telephone call. A. late B. quite C. for D. telephone

Diseases due to ________ abnormalities are termed primary immunodeficiencies.

What are the structural and functional similarities and differences between mitochondria and chloroplasts?

A 46-year-old man is currently enrolled in a Phase 2 study of a drug for severe diabetic neuropathy. While the study is on-going, a new drug becomes commerciall

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

What did the authors of the Declaration of Independence mean by "unalienable rights?" Rights for legal citizens and not immigrants Natural rights that no gov

During the Mesozoic period, diapsids diverged into_______. pterosaurs and dinosaurs mammals and reptiles lepidosaurs and archosaurs Testudines and Sphenodontia

What is another name for Trichuris trichiura? pinworm whipworm hookworm ascariasis

I NEED HELP ASAP!!!!!!!!! Choose three of the following events or actions to profile in a presentation: Montgomery bus boycott Watts Riots Selma March Children'

Both Apple and Nike produce their products and own retail outlets. They also rely on independent distributors to sell their offerings. Apple and Nike are utiliz