prosier47 prosier47

08-11-2018
Biology

contestada

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Respuesta :

taylorskyrme taylorskyrme

19-11-2018

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine

Answer Link

Otras preguntas

In general, the most materially advanced and developed countries are focused on extensive development of the _______ sector of their economy. A. quaternary B.

A tortoise and a hare are having a race the tortoise is crawls at a constant rate without stopping. the hare(who is confident he will win) hops ahead,stops to w

julia paid a total of $66.45 for five shirts. she paid $5.20 in sales tax. what was the price of each shirt?

When Congress refused to pay soldiers who had won the American revolution, conflict between soldiers on Congress was resolved by?

In Act II, scene 3 of Romeo and Juliet, what is Friar Laurence doing when Romeo goes to see him? A. Gathering herbs B. Listening to confession C. Reading his Bi

A tortoise and a hare are having a race the tortoise is crawls at a constant rate without stopping. the hare(who is confident he will win) hops ahead,stops to w

what is 1 3/10 - 5/14

What characteristic of water accounts for its properties of adhesion, cohesion, high specific heat, and nature as a solvent

Identify the factors of the terms of the expression 5+6a+11b

Write 4=(-8) + 3x as a decimal