Hjohn22 Hjohn22

07-10-2019
Mathematics

contestada

What is the equation of a line that is parallel to the line y=10 and passes through the point (-5,8)?

Respuesta :

07-10-2019

Answer:

y=8

Step-by-step explanation:

If the horizontal line is at y=8, it crosses through every x value at y=8, including (-5,8)

Answer Link

Otras preguntas

Harry is facing an important test and expects to do poorly. He is so anxious that he cannot concentrate or study effectively, but he figures that because he's g

Consider the relative liquidity of the following assets: Assets 1. A share in a publicly traded company 2. The funds in a savings account 3. A $10 bill 4. Your

If A= 2x - 7x^2 + 3 and B= 4x^2 - 12x, what is A + B? A) 6x^2 - 7x - 9 B) 3x^2 - 10x + 3 C) -3x^2 - 10x + 3 D) -3x^2 + 10x + 3

In the 1890s, Nobel Brothers Petroleum Company and Marcus Samuel's Transport and Trading Company dominated the Asian oil market. А. ВР B. Exxon C. Hess D. Shell

CrossCountry Trucking & Transport enters into a contract with Discount Outlet Stores to load, transport, deliver, and unload the cargo that Discount designa

Monty is reading when he sees an insect land on the corner of his book. He then makes an eye movement to look at the insect, and then he swats at it to squash i

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT Question 1 options: 14 and 1

Clyde simplified ( j-8)-2. j Superscript (negative 8) + (negative 2) baseline = j superscript negative 10 Baseline = StartFraction 1 Over j Superscript 10 EndF

the writer simply states a fact about a character. indirect characterization personal characterization direct characterization

Myosin is a contractile protein found in muscles that is composed of three pairs of subunits, two heavy chains, and two pairs of two different types of light ch