kennadie1 kennadie1

09-12-2019
Spanish

contestada

According to the reading, what is needed for students that want to study at universities like Harvard, Oxford, Cambridge, or MIT?

Respuesta :

lorenyzerquera95 lorenyzerquera95

10-12-2019

Los estudiantes para estudiar en estas univercidades ,necesitan un buenos creditos

Answer Link

Otras preguntas

What is the length of chord cd in o below

Carol has been addicted to narcotics for many years. Recently, she has been trying to quit and has not used any drugs for the last week. We can expect that Caro

(PLEASE HELP) Identify the underlined word or group of words in the following sentence: "Since the dawn of time", water has been an important molecule. A)adverb

16. Which sport was Lubar playing when he had his "moment of greatness"? * kickball football softball basketball

Ellie is an African elephant. When she was born, she weighed about 200 pounds. As an adult, she weighs 7 tons! How many pounds did Ellie gain over her lifetime?

Amanda lives in Fairbanks Alaska she records the low temperature for five days, which days low temperature was 9c colder than the low temperature

Which of the following was the result on appeal in Telekenex IXC, Inc. v. Charlotte Russe, Inc., the case in the textbook in which the defendant claimed that an

Od niedawna masz psa napisz e-maila do koleżanki z usa opisz wygląd swojego psa napisz jaki jest twój pies i co o nim sądzisz opisz swoją role w opiekowaniu się

A __________ is a restriction of trade between the U.S. and another country in order to force the country to stop an action (or to get them to DO a certain acti

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG