michaelboehm26 michaelboehm26

08-05-2020
Mathematics

contestada

What is the median of the data represented in the box plot below
20
30
40
50

What is the median of the data represented in the box plot below 20 30 40 50 class=

Respuesta :

watsonariana6 watsonariana6

08-05-2020

The median of the data is 40.

Answer Link

ilovedamonsalvatore ilovedamonsalvatore

08-05-2020

40 is the answer!!!!!

Answer Link

Otras preguntas

solve the system of equations y=2x[tex]y=2x^{2} -3\\y=3x-1[/tex]

Who BESTcompletes this word web? A.John Tower B.Barbara Jordan C.Sam RayburnD. Lloyd Bentsen

Researchers were working to determine the evolutionary history of modern horses using fossils of four horse ancestor species in North America. They had incomple

A rope passing through a capstan on a dock is attached to a boat offshore. The rope is pulled in at a constant rate of 2 ft/s, and the capstan is 5 ft vertical.

Courts will enforce contracts for the benefit of all but which of the following? a.Donee beneficiaries. b.Creditor beneficiaries. c.Incidental beneficiaries. d.

Use the following DNA sequence to answer these questions.Make sure to explain/justify your answers. This piece of DNA is 29 bases long. 5' GACCGATCGGCTAAGCATCAC

Which cause is eleanor roosevelt most assiociated withA..humanirianismB. pacifismC. evironmentalismD.conservatism

Who did the after hours club owners think bulworth was?

Identify a characteristic of conflicted couples. a) They have never considered divorce in spite of conflicts.b) They have low scores in communication and confli

When aggregate demand is excessive relative to the economy's full-employment level of real output, the central bank will institute Blank______ monetary policy.