ewalto9765 ewalto9765

07-10-2020
Mathematics

contestada

What is the slope of the line that passes through the points (2, 1) and (17, -17)

Respuesta :

GeorgePP GeorgePP

07-10-2020

Answer: -6/5

Step-by-step explanation:

Do the formula, change in y divided by the change in x.

(-17 - 1)/(17-2) = -18/15 = -6/5

Answer Link

Otras preguntas

When entering a foreign market, Montain stream brewery purchases a manufacturing plant and sets up a new brewery. Instead of using their signature name, the pro

What is the purpose of the Synthesis (S) phase of the cell cycle? A. Create a copy of the cell B. Synthesize extra organelles C. Duplication of RNA D. Duplicati

One of the reasons it has been so difficult for Congress to bring federal spending under control is becauseA.the crowding-out effect has been ineffective.B.the

2**2-5 what is answer of this equation

0.7Two adjacent angles are equal. Is it necessary that each of these angles will beright angle? Justify your answer.

Refer to Explorations in Literature for a complete version of this narrative. Why does the author begin "Oasis: Africa" with a description of the landscape and

Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC How many bases are in the second fragment?

El conocimiento y la identificación de vulnerabilidades es una función crucial de un especialista en ciberseguridad. ¿Cuáles de los siguientes recursos se puede

PLEASE HELP ASAP! Describe The Rocky Mountains. I will mark brainliest.

Which of the following statements is false? a. A feasible solution satisfies all constraints. b. In a linear programming problem, the objective function and t