alexi565 alexi565

11-11-2020
Arts

contestada

what is the meaning of the painting Blue and green music by Georgia O'keeffe?

Respuesta :

mlempitski1 mlempitski1

11-11-2020

Omg. I don’t know the meaning, but we played a price based on the painting in band last year and I loved it. I just had to make the connection :)

Answer Link

Otras preguntas

Which exponential expression represents the numerical expression 9⋅9⋅9? A.39 B .3×9 C. 9×3 D. 93 If you solve this I'LL GIVE YOU BRAINLIST

When graphically depicting frequency distributions, a _____ uses bars to display a frequency distribution for a quantitative variable?

Develop a strategy to store food that's left over from dinner?

What is the rule for copareing ffracitions with the same numnuber?

Select the vocabulary word that best completes the sentence. Oregano is the _____ ingredient in making the salsa taste unique. A literal B label C key D

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Joseph Addison says in his essay "Argument" that it is ridiculous to get angry at somebody who doesn't share your opinion. A) You can consider that person a fo

Find the mean and range 20, 14, 29, 39, 33, 25, 19, 35 A: mean=28.45; range=25 B: mean=26.75; range=25 C: mean=25.35; range=26 D: mean= 26.75; range=28

What are the promontories that Bede describes in A History of the English Church and People? A. peaks of high coastal land B. castles with strong walls

Select the sentence below that uses proper punctuation to separate a nonessential phrase from the main sentence. A.Kimberly was so hungry - she hadn’t eaten all