jls7281 jls7281

08-01-2021
Biology

contestada

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Respuesta :

mathsbeginer mathsbeginer

12-01-2021

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Answer Link

Otras preguntas

Lithium nitride reacts with water to produce ammonia and lithium hydroxide according to the equation Li 3 N ( s ) + 3 H 2 O ( l ) ⟶ NH 3 ( g ) + 3 LiOH ( aq ) H

whats 2+2? I do not understand

According to path-goal theory, encouraging employees to perform at their highest level by setting challenging goals, emphasizing excellence, and demonstrating c

What number does y stand for in this equation? 2y - 7 = 35

Which of these statements is a fact?A. Light weight rackets are best for beginners to use.B. Roger Federer is the best top tennis player of all time.C. Wimbledo

Suppose the codeword length is 8. Answer the following questions, with proper justification. in. (10 points) Give an example of undetectable error burst of leng

There are 104 students in class 9 and 96 students in class 10 in school. In an examination the students are to be seated in parallel rows such that no two adjac

8. It can be said that a vaccine does not prevent infection; rather it primes the immune system to respond to an invader. Using information about human immune r

How to change this mark- I got 35 out to of 40 in SST,how do I convert the mark out of 80??? With explaination

Lucy’s Swimwear Boutique offers swimwear that is targeted at affluent people who can afford to buy expensive, handmade swimsuits. Which of the following approac