ab142674 ab142674

09-05-2021
Mathematics

contestada

x-3/-7 ≤ 8
Solve the inequality.

Respuesta :

Purplefox1212 Purplefox1212

09-05-2021

Answer:

x is less than or equal to 59/7

Step-by-step explanation:

Answer Link

Otras preguntas

I have a Brainliest reward

what is the molecular formula for strychnine

How could the procedures used in this experiment be altered to measure bacteriostatic effects?

PLEASE HELP!!!The radius of a circle is 10. Using π, which equation expresses the ratio of the circumference of the circle to the circle's diameter? A) C/10

Which piece of textual evidence best supports the main character's dual existence? A. "These passed away, and left me faint; and then as in its turn th

Explain why Earth and other planets were not solid when they formed during the beginning of the Precambrian, approximately 4,600 million years ago (MYA). What

what is the purpose of mitosis?

For what values of m does the graph of y=mx^2-5x-2 have no x-intercepts

Which epic element is illustrated in lines 11-23 Odysseus

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’