joeyrama2005 joeyrama2005

15-08-2021
Mathematics

contestada

What is the volume of the right rectangular prism?

a) 21cm^3
b) 42cm^3
c) 120cm^3
d) 240cm^3

What is the volume of the right rectangular prism a 21cm3 b 42cm3 c 120cm3 d 240cm3 class=

Respuesta :

Ashisingh Ashisingh

15-08-2021

Answer:

c part is correct answer

Answer Link

Rodriguez905 Rodriguez905

16-05-2022

Answer: D) 240 cm^3

Step-by-step explanation:

On edge

Ver imagen Rodriguez905

Answer Link

Otras preguntas

Drag each pair of numbers to show if their greatest common factor (GCF) is less than 3, equal to 3, equal to 5, or greater than 5.

In an argumentative research essay, what is one role that reasons play? A. Reasons give readers a final thought to take from the essay. B. Reasons introduce the

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

I need to write an essay on Islamic, Judaism, and christianity what is important for me to know about them?

A political organization that focuses on quid-pro-quo exchanges with voters, offering them jobs or other benefits in exchange for their votes, and ignores issue

I WILL AWARD BRAINLIEST IF YOU ANSWER ALL OF THESE!! THANK YOU!! Find the number if: 5% of it is 23% of 15.5 4% of it is 31% of 16.4 4.5% of it is 23% of 45 5.5

Matilda has about 6 missing cases on her index of voting interest out of 1500 respondents. The best strategy for handling these missing case would be to:

Pizza Hut's website __________ are integrated with the company's overall communications programs - including traditional media - with product innovations, promo

Which is greater than 4? (a) 5, (b) -5, Which is the smallest? (a) -1

According to public health officials, in 1998 Massachusetts became the first state in which more babies were born to women over the age of thirty than under it.