matthewmckittrick8 matthewmckittrick8

13-12-2021
Mathematics

contestada

3. Let Angle ABC be an isosceles triangle with AB = AC. Which of the following describes
LB of the triangle?
A. Exterior Angle
B. Base Angle
C. Vertex Angle
D. Remote Interior Angle

Will mark Brainiest

Respuesta :

johnathanluna789 johnathanluna789

13-12-2021

Answer:
It’s should be D because
Step by step explanation

Answer Link

Otras preguntas

The dresser has a weight of 80 lb and is pushed along thefloor. If the coefficient of static friction at Aand B is μs = 0.3 and thecoefficient of kinetic fricti

shows a particle of mass m at distance x along the axis of a very thin ring of mass m and radius r. calculate the gravitational potential energy of these two ma

you are holding short for an intersection departure on runway 8 with the sign in front of you. which way should you turn when taxiing onto the runway to depart

how to solve ??? i know the basics of terms like square foot transformations but it’s hard to match it with an already made function

Empire and colonialism are major concepts throughout this work. Pay close attention to how Conrad uses, or critiques, the rhetoric of empire. What is your inter

mercuric oxidation in water, followed by nabh4 reduction results in markovnikov addition of water. draw the mechanism and predict the major organic product.

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

To support National Heart Week, the Heart Association plans to install a free blood pressure testing booth in El Con Mall for the week. Previous experience indi

You are given two circuits with two batteries of emf EMF and internal resistance R1 each. Circuit A has the batteries connected in series with a resistor of res

consider two different isotopes of the same neutral element. which statements about these isotopes are true? (there may be more than one correct choice.)