1165310 1165310

06-07-2017
Mathematics

contestada

What type of triangle has side lengths of 4, 7, and 9?

A.
acute
B.
right
C.
obtuse
D.
The lengths do not form a triangle.

Respuesta :

jujuloulou jujuloulou

06-07-2017

acute is your answer

Answer Link

Otras preguntas

Two cars leave the same place at the same time, but drive in opposite directions along a straight road. One car averages 55 mi/h and the other averages 65 mi/h.

Lilliputians can be sentenced to death for the crime of A. theft. B. pillage. C. murder. D. ingratitude.

bonzoor what does this means

Which expression is equivalent to the expression below? Select all that apply. –2/5(15 – 20d + 5c)

A company dyes two sizes of rugs. A small rug requires 8 hours for dyeing and a medium-size rug requires 12 hours for dyeing. The dyers have to make at least 22

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

(3 multiple choice chemistry questions) Will give brainliest!!!! 1. You measure a tall tree to be 227 meters tall, how many millimeters is this? A. 227 mm B. 0

5. (03.01) Dylan created color panels for a wall using a mix of only green and blue paints. He plotted the quantities of blue and green paints used for each mix

[tex] {3}^{4 \times } {7}^{2} [/tex]

why is it important for business to know exchange rates?